Instructions to use multimolecule/scbasset with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/scbasset with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/scbasset") model = AutoModel.from_pretrained("multimolecule/scbasset") inputs = tokenizer("ACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGGCCAAGACCTGCCCTGTGCAGCTGTGGGTTGATTCCACACCCCCGCCCGGCACCCGCGTCCGCGCCATGGCCATCTACAAGCAGTCACAGCACATGACGGAGGTTGTGAGGCGCTGCCCCCACCATGAGCGCTGCTCAGATAGCGATGG", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
scBasset
Sequence-based convolutional neural network for modeling single-cell ATAC-seq chromatin accessibility from DNA sequence.
Disclaimer
This is an UNOFFICIAL implementation of scBasset: sequence-based modeling of single-cell ATAC-seq using convolutional neural networks by Han Yuan, et al.
The OFFICIAL repository of scBasset is at calico/scBasset.
The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.
The team releasing scBasset did not write this model card for this model so this model card has been written by the MultiMolecule team.
Model Details
scBasset is a convolutional neural network (CNN) that predicts per-cell chromatin accessibility of a DNA peak sequence. The model consumes a fixed-length 1344 bp one-hot encoded DNA sequence and applies a pre-activation convolution stem, a reducing convolution tower, a pointwise convolution, and a dense bottleneck before a final cell-embedding layer that produces one accessibility logit per single cell.
scBasset uses a pre-activation block layout: each convolution block applies the activation (the sigmoid approximation of GELU, sigmoid(1.702 * x) * x) before the convolution, then batch normalization and max pooling. The dense bottleneck flattens the convolution output in Keras channels-last (length-major) order.
The final cell-embedding (dense) layer of scBasset is dataset-specific: it has one row per single cell in the training atlas. The Buenrostro2018 hematopoiesis tutorial dataset distributed by the scBasset authors has 2034 single cells (so
num_labels = 2034). A different scBasset dataset would have a different number of cells and a differently sized cell-embedding layer.
The cell-embedding layer is exposed through the shared [SequencePredictionHead][multimolecule.SequencePredictionHead]; the per-cell accessibility task is modeled as a binary problem (problem_type="binary").
Model Specification
| Num Conv Layers | Hidden Size | Num Cells | Num Parameters (M) | FLOPs (G) | MACs (G) | Max Num Tokens |
|---|---|---|---|---|---|---|
| 8 | 32 | 2034 | 4.59 | 0.95 | 0.47 | 1344 |
Links
- Code: multimolecule.scbasset
- Data: scBasset Buenrostro2018 tutorial data
- Paper: scBasset: sequence-based modeling of single-cell ATAC-seq using convolutional neural networks
- Developed by: Han Yuan, David R. Kelley
- Model type: 1D CNN backbone with learned per-cell embedding head for single-cell ATAC-seq accessibility prediction
- Original Repository: calico/scBasset
Usage
The model file depends on the multimolecule library. You can install it using pip:
pip install multimolecule
Direct Use
Single-Cell Chromatin Accessibility Prediction
You can use this model directly to predict per-cell chromatin accessibility of a DNA peak sequence:
>>> from multimolecule import DnaTokenizer, ScBassetForSequencePrediction
>>> tokenizer = DnaTokenizer.from_pretrained("multimolecule/scbasset")
>>> model = ScBassetForSequencePrediction.from_pretrained("multimolecule/scbasset")
>>> input = tokenizer("ACGT" * 336, return_tensors="pt")
>>> output = model(**input)
>>> output.logits.shape
torch.Size([1, 2034])
Each of the 2034 logits is a per-cell accessibility score for the Buenrostro2018 hematopoiesis atlas.
Interface
- Input length: fixed 1344 bp DNA peak window
- Output: per-cell accessibility logits (2034 cells in the Buenrostro2018 hematopoiesis atlas; cell count is dataset-specific)
Training Details
scBasset was trained to predict the per-cell chromatin accessibility of DNA peak sequences across a single-cell ATAC-seq atlas.
Training Data
The scBasset model uses the Buenrostro2018 hematopoiesis tutorial model trained on the Buenrostro et al. 2018 single-cell ATAC-seq hematopoiesis dataset (2034 single cells). Each 1344 bp peak is associated with a per-cell binary accessibility vector.
Training Procedure
Pre-training
The model was trained to minimize a per-cell binary cross-entropy loss, comparing its predicted per-cell accessibility probabilities (sigmoid of the cell-embedding logits) against the observed single-cell ATAC-seq accessibility labels.
- Optimizer: Adam
- Loss: Per-cell binary cross-entropy
- Regularization: Batch normalization and dropout
Citation
@article{yuan2022scbasset,
author = {Yuan, Han and Kelley, David R.},
title = {scBasset: sequence-based modeling of single-cell ATAC-seq using convolutional neural networks},
journal = {Nature Methods},
volume = 19,
number = 9,
pages = {1088--1096},
year = 2022,
publisher = {Nature Publishing Group},
doi = {10.1038/s41592-022-01562-8}
}
The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:
@software{chen_2024_12638419,
author = {Chen, Zhiyuan and Zhu, Sophia Y.},
title = {MultiMolecule},
doi = {10.5281/zenodo.12638419},
publisher = {Zenodo},
url = {https://doi.org/10.5281/zenodo.12638419},
year = 2024,
month = may,
day = 4
}
Contact
Please use GitHub issues of MultiMolecule for any questions or comments on the model card.
Please contact the authors of the scBasset paper for questions or comments on the paper/model.
License
This model implementation is licensed under the GNU Affero General Public License.
For additional terms and clarifications, please refer to our License FAQ.
SPDX-License-Identifier: AGPL-3.0-or-later
- Downloads last month
- 26